Analýza mikrobiálního genomu

Taxonomická analýza mikrobiálních společenstev pomocí sekvenování amplikonů

Sekvenování metagenomu / mikrobiomu od 700 Kč za vzorek!

Chcete-li analyzovat výskyt mikroorganizmů v určitém prostředí - provádět tzv. analýzu metagenomu či mikrobiomu, je Next-Generation sekvenování velmi efektivním nástrojem první volby, protože umožňuje identifikaci všech druhů v testovaných vzorcích. Nejčastěji používaná strategie je založena na sekvenování amplikonů získaných amplifikací hypervariabilních oblastí genů pro ribozomální podjednotky (jako 16S, 18S nebo ITS). Tyto oblasti jsou již tradičně využívány k identifikaci organizmů na základě srovnání získaných sekvencí s referenčními databázemi. (Alternativním přístupem je shotgunové sekvenování celého vzorku tedy bez amplifikace 16S, 18S nebo ITS oblastí, případně metatranskriptomická analýza. V případě zájmu o tyto služby nás prosím kontaktujte.)


Laboratorní zpracování

Naše laboratorní strategie je navržena tak, aby byla dostatečně robustní pro různé typy vzorků. Vaše vzorky budou zpracovány tímto postupem:

  • Amplifikace vybraných hypervariabilních oblastí. Pro amplifikaci používáme níže uvedené primerové kombinace (jejich výběr reflektuje mimo jiné i kompatibilitu s projekty typu Earth Microbiome project apod.)
  • Kontrola produktů na agarózovém gelu
  • Vytvoření dvojitě indexovaných sekvenačních knihoven metodou PCR
  • Kvantifikace knihoven pomocí qPCR pro dosažení maximálně vyrovnaného sekvenačního výtěžku
  • Sekvenace na systémech Illumina standardně v nastavení paired-end s délkou sekvencí 250 bazí

Pro taxonomickou analýzu lze použít různé hypervariabilní genové úseky. V tabulce níže uvádíme primerové kombinace (sety), které používáme k amplifikaci těchto cílových úseků a předpokládanou velikost produktů. Takto získané produkty jsou následně sekvenovány.

 

Jaké primery používáme pro taxonomickou analýzu

Říše Gen Cílová oblast Oficiální název primeru Sekvence Produkt (bp)
Bakterie 16S rRNA V4-V5 V4-V5 515F GTGYCAGCMGCCGCGGTAA 420+
V4-V5 R926 CCGYCAATTYMTTTRAGTTT
V3-V5 V3-V5 F357 CCTACGGGNGGCWGCAG 694
V3-V5 R926 CCGYCAATTYMTTTRAGTTT
V3-V4 V3-V4 F357 CCTACGGGNGGCWGCAG 540
V3-V4 R805 GACTACHVGGGTATCTAATCC
V4* V4 515F GTGYCAGCMGCCGCGGTAA 252
V4 806R GGACTACNVGGGTWTCTAAT
Archea 16S rRNA 349-806* Arch349F GYGCASCAGKCGMGAAW 528
Arch806R GGACTACVSGGGTATCTAAT
Eukaryota 18S rRNA ITS1+ITS2 ITS1F GGTCATTTAGAGGAAGTAA 580+
ITS4R TCCTCCGCTTATTGATATGC
ITS2* ITS3F GCATCGATGAAGAACGCAGC 462
ITS4R TCCTCCGCTTATTGATATGC
1391-3' end Euk_1391F GTACACACCGCCCGTC 200-280
EukBr-7R TGATCCTTCTGCAGGTTCACCTAC

*Pro tyto oblasti je možné analýzu objednat již od jednoho vzorku.

 


Výsledky a záruka

Garantujeme, že pro každý vzorek, který projde vstupní kontrolou kvality, získáte minimálně 20.000 readů. Na přání je možné tento výstup navýšit (zpoplatněno).

Získané sekvence budou roztříděny dle kombinace indexů do souborů reprezentujících jednotlivé vzorky a bude provedena analýza ukazatelů kvality sekvenace, jako je počet a délka sekvencí, phred score, %GC, úroveň duplikace atp.

Jako výstup obdržíte data ve formátu FASTQ rozdělená do souborů dle jednotlivých vzorků. Na přání lze výstupy zpracovat i v jiné formě. Tento požadavek prosím uveďte při objednání.


Analýza dat

K laboratornímu zpracování vzorků lze současně objednat i analýzu dat, která zahrnuje:

  • Kontrolu kvality dat
  • Spojení párových readů
  • Dereplikaci (klastrování)
  • Taxonomickou analýzu a vizualizaci výsledků
  • Vypracování zprávy o provedené analýze (vzor na vyžádání)

Výsledky budou zpracovány v přehledné formě (tabulky, grafy) a budou demonstrovat semikvantifikované zastoupení mikroorganismů. Máte-li již hrubá data k dispozici, můžete objednat jejich analýzu samostatně.

 


Doba zpracování

Méně než 4 týdny (nezahrnuje analýzu dat)


Kurz nebo workshop

  • Máte-li zájem naučit se analyzovat získaná data, navštivte náš pravidelně organizovaný workshop!
  • Začátečníkům doporučujeme rovněž účast na našem dvoudenním úvodním kurzu NGS.

Požadavky na vzorky

Dodržujte naše Pokyny pro přípravu vzorků.

Vzorky musí být dodány přesně v koncentraci dle návodu! Příliš nízká koncentrace by mohla vést k nízkému výtěžku PCR, vysoká koncentrace k rozdílným výtěžkům nebo i inhibici reakce (vysoká koncentrace DNA může být spojena s vysokou koncentrací inhibitorů). Při izolaci DNA mějte na paměti, že častější promytí a nižší výtěžek je určitě lepší než vyšší výtěžek s inhibitory. Vzorky na metagenomické analýzy prosím dodávejte ve stripech nebo 96-jamkových destičkách.

Je doporučeno, aby alespoň jeden z Vámi zaslaných vzorků byla negativní kontrola. Jako vhodnou kontrolu lze např. použít čistou vodu, z níž „izolujete“ DNA pomocí stejné procedury jako z reálných vzorků (protože ne všechny izolační soupravy jsou DNA-free).

Upozorňujeme, že úspěch analýzy velmi závisí na integritě a čistotě DNA, kterou nám dodáte! Použití degradované nebo kontaminované DNA vede ke vzniku amplifikačních artefaktů. Kontaminace, které interferují s amplifikací, představují pochopitelně rovněž komplikaci. Doporučujeme během izolace DNA odstranit RNA.


Jak službu objednat

Analýzu lze objednat ve dvou formátech:

  • Již od 1 vzorku! Tato možnost je dražší, ale máte možnost zaslat skutečně třeba jen jeden vzorek. Můžete však využít pouze vybrané kombinace primerů (viz výše).
  • Jako balíček pro 24, 48, 96 nebo 192 vzorků. Jedná se o cenově optimální variantu a můžete využít naši kompletní nabídku primerových párů.

 OBJEDNAT 

 

© SEQme s.r.o., 2012 - 2020. Všechna práva vyhrazena. Právní upozornění.
webdesign Beneš & Michl