Analýza mikrobiálního genomu

Taxonomická analýza mikrobiálních společenstev pomocí sekvenování amplikonů

Sekvenování metagenomu / mikrobiomu od 700 Kč za vzorek!

Chcete-li analyzovat výskyt mikroorganizmů v určitém prostředí - provádět tzv. analýzu metagenomu či mikrobiomu, je Next-Generation sekvenování velmi efektivním nástrojem první volby, protože umožňuje identifikaci všech druhů v testovaných vzorcích. Nejčastěji používaná strategie je založena na sekvenování amplikonů získaných amplifikací hypervariabilních oblastí genů pro ribozomální podjednotky (jako 16S, 18S nebo ITS). Tyto oblasti jsou již tradičně využívány k identifikaci organizmů na základě srovnání získaných sekvencí s referenčními databázemi. (Alternativním přístupem je shotgunové sekvenování celého vzorku tedy bez amplifikace 16S, 18S nebo ITS oblastí, případně metatranskriptomická analýza. V případě zájmu o tyto služby nás prosím kontaktujte.)


Laboratorní zpracování

Naše laboratorní strategie je navržena tak, aby byla dostatečně robustní pro různé typy vzorků. Vaše vzorky budou zpracovány tímto postupem:

  • Amplifikace vybraných hypervariabilních oblastí. Pro amplifikaci používáme níže uvedené primerové kombinace (jejich výběr reflektuje mimo jiné i kompatibilitu s projekty typu Earth Microbiome project apod.)
  • Kontrola produktů na agarózovém gelu
  • Vytvoření dvojitě indexovaných sekvenačních knihoven metodou PCR
  • Kvantifikace knihoven pomocí qPCR pro dosažení maximálně vyrovnaného sekvenačního výtěžku
  • Sekvenace na systémech Illumina standardně v nastavení paired-end s délkou sekvencí 250 bazí

Pro taxonomickou analýzu lze použít různé hypervariabilní genové úseky. V tabulce níže uvádíme primerové kombinace (sety), které používáme k amplifikaci těchto cílových úseků a předpokládanou velikost produktů. Takto získané produkty jsou následně sekvenovány.

 

Jaké primery používáme pro taxonomickou analýzu

Říše Gen Cílová oblast Oficiální název primeru Sekvence Produkt (bp)
Bakterie 16S rRNA V4-V5 V4-V5 515F GTGYCAGCMGCCGCGGTAA 420+
V4-V5 R926 CCGYCAATTYMTTTRAGTTT
V3-V5 V3-V5 F357 CCTACGGGNGGCWGCAG 694
V3-V5 R926 CCGYCAATTYMTTTRAGTTT
V3-V4 V3-V4 F357 CCTACGGGNGGCWGCAG 540
V3-V4 R805 GACTACHVGGGTATCTAATCC
V4 V4 515F GTGYCAGCMGCCGCGGTAA 252
V4 806R GGACTACNVGGGTWTCTAAT
Archea 16S rRNA 349-806 Arch349F GYGCASCAGKCGMGAAW 528
Arch806R GGACTACVSGGGTATCTAAT
Eukaryota 18S rRNA ITS1+ITS2 ITS1F GGTCATTTAGAGGAAGTAA 580+
ITS4R TCCTCCGCTTATTGATATGC
ITS2 ITS3F GCATCGATGAAGAACGCAGC 462
ITS4R TCCTCCGCTTATTGATATGC
1391-3' end Euk_1391F GTACACACCGCCCGTC 200-280
EukBr-7R TGATCCTTCTGCAGGTTCACCTAC

 


Výsledky a záruka

Pro každý vzorek, který projde vstupní kontrolou kvality, byste měli získat minimálně 20.000 readů, tento výstup nicméně není garantován a to s ohledem na specifika toho kterého vzorku. Na přání je možné sekvenační výstup navýšit (zpoplatněno).

Získané sekvence budou roztříděny dle kombinace indexů do souborů reprezentujících jednotlivé vzorky a bude provedena analýza ukazatelů kvality sekvenace, jako je počet a délka sekvencí, phred score, %GC, úroveň duplikace atp.

Jako výstup obdržíte data ve formátu FASTQ rozdělená do souborů dle jednotlivých vzorků. Na přání lze výstupy zpracovat i v jiné formě. Tento požadavek prosím uveďte při objednání.


Analýza dat

K laboratornímu zpracování vzorků lze současně objednat i analýzu dat, která zahrnuje:

  • Kontrolu kvality dat
  • Trimming
  • OTU klastrování
  • Klasifikaci
  • Taxonomickou analýzu a vizualizaci výsledků

Výsledky budou zpracovány v přehledné formě (tabulky, grafy) a budou demonstrovat semikvantifikované zastoupení mikroorganismů. Máte-li již hrubá data k dispozici, můžete objednat jejich analýzu samostatně.

 


Doba zpracování

Asi 6 týdnů (bez analýzy dat)


Kurz nebo workshop

  • Máte-li zájem naučit se analyzovat získaná data, navštivte náš pravidelně organizovaný workshop!
  • Začátečníkům doporučujeme rovněž účast na našem dvoudenním úvodním kurzu NGS.

Požadavky na vzorky

Dodržujte naše Pokyny pro přípravu vzorků.

Vzorky musí být dodány přesně v koncentraci dle návodu! Příliš nízká koncentrace by mohla vést k nízkému výtěžku PCR, vysoká koncentrace k rozdílným výtěžkům nebo i inhibici reakce (vysoká koncentrace DNA může být spojena s vysokou koncentrací inhibitorů). Při izolaci DNA mějte na paměti, že častější promytí a nižší výtěžek je určitě lepší než vyšší výtěžek s inhibitory. Vzorky na metagenomické analýzy prosím dodávejte ve stripech nebo 96-jamkových destičkách.

Je doporučeno, aby alespoň jeden z Vámi zaslaných vzorků byla negativní kontrola. Jako vhodnou kontrolu lze např. použít čistou vodu, z níž „izolujete“ DNA pomocí stejné procedury jako z reálných vzorků (protože ne všechny izolační soupravy jsou DNA-free). My vždy přidáme naši vlastní negativní a pozitivní kontrolu.

Upozorňujeme, že úspěch analýzy velmi závisí na integritě a čistotě DNA, kterou nám dodáte! Použití degradované nebo kontaminované DNA vede ke vzniku amplifikačních artefaktů. Kontaminace, které interferují s amplifikací, představují pochopitelně rovněž komplikaci. Doporučujeme během izolace DNA odstranit RNA.


Jak službu objednat

Analýzu lze objednat jako balíček pro 24, 48, 94 nebo 190 vzorků. Chcete-li objednat analýzu jiného počtu vzorků (např. jen několik málo vzorků nebo naopak tisíce), kontaktujte nás pro vypracování individuální kalkulace.

 

 OBJEDNAT 

 

© SEQme s.r.o., 2012 - 2021. Všechna práva vyhrazena. Právní upozornění.
webdesign Beneš & Michl