Microbial genome analysis

Unbiased taxonomic analysis of microbial communities by amplicon sequencing

Metagenome / microbiome sequencing – from EUR 30 per sample!

If you want to analyze the presence of microorganisms in a particular environment - perform a so-called metagenome or microbiome analysis, Next-Generation sequencing is a very effective first choice tool, as it allows identification of all species in test samples. The most commonly used strategy is based on sequencing amplicons obtained by amplifying hypervariable regions of the ribosomal subunit gene (such as 16S, 18S or ITS). These areas are traditionally used to identify organisms by comparing the sequences obtained with reference databases. (An alternative approach is shotgun sequencing of the whole sample, i.e. without amplification of 16S, 18S or ITS regions, or metatranscriptomic analysis. If you are interested in these services, please contact us.)


Laboratory processing

Our laboratory strategy is designed to be robust enough for different sample types. Your samples will be processed as follows:

  • Amplification of selected hypervariable regions. For amplification we use the following primer combinations (their selection reflects, among other things, compatibility with the Earth Microbiome project)
  • Agarose gel product check
  • Creation of double indexed sequencing libraries by PCR
  • Quantification of libraries by qPCR to achieve maximum balanced sequencing yield
  • Sequencing on Illumina systems by default in paired-end setup with 250 base sequence length

 

What primers we use for taxonomic analysis

Domain Gene Target region Official primer name Sequence Product (bp)
Bacteria 16S rRNA V4-V5 V4-V5 515F GTGYCAGCMGCCGCGGTAA 420+
V4-V5 R926 CCGYCAATTYMTTTRAGTTT
V3-V5 V3-V5 F357 CCTACGGGNGGCWGCAG 694
V3-V5 R926 CCGYCAATTYMTTTRAGTTT
V3-V4 V3-V4 F357 CCTACGGGNGGCWGCAG 540
V3-V4 R805 GACTACHVGGGTATCTAATCC
V4* V4 515F GTGYCAGCMGCCGCGGTAA 252
V4 806R GGACTACNVGGGTWTCTAAT
Archaea 16S rRNA 349-806* Arch349F GYGCASCAGKCGMGAAW 528
Arch806R GGACTACVSGGGTATCTAAT
Eukaryotes 18S rRNA ITS1+ITS2 ITS1F GGTCATTTAGAGGAAGTAA 580+
ITS4R TCCTCCGCTTATTGATATGC
ITS2* ITS3F GCATCGATGAAGAACGCAGC 462
ITS4R TCCTCCGCTTATTGATATGC
1391-3' end Euk_1391F GTACACACCGCCCGTC 200-280
EukBr-7R TGATCCTTCTGCAGGTTCACCTAC

*For these target regions this service is available starting from a single sample

 


Results guarantee

We guarantee that you get at least 20,000 reads for each sample that passes the initial quality control. Upon request, this output can be increased (charged).

The sequences obtained will be sorted according to the combination of indexes into files representing individual samples and analysis of sequencing quality indicators such as number and length of sequences, phred score, %GC, duplication level, etc. will be performed.

As output you will receive data in FASTQ format divided into files according to individual samples. Upon request, the outputs can be processed in another form. Please specify this when ordering.


Data analysis

For laboratory processing of samples it is also possible to order data analysis, which includes:

  • Data QC
  • Paired end read merging
  • Dereplication (Clustering)
  • Taxonomy analysis
  • Data visualization
  • Data analysis report (example on request)

The results will be processed in a form of tables/graphs and will demonstrate semi-quantified representation of microorganisms. If you already have raw data available, you can order their analysis separately.

 


Processing time

Less than 4 weeks (data analysis not included)


Course or workshop

  • If you are interested in learning how to analyze the data, visit our regularly organized workshop!
  • Beginners may also consider our 2 day NGS introductory course.

How to order the service

The analysis can be ordered and commissioned online in two formats:

  • From 1 sample! This option is more expensive, but you can actually send even a single sample. However, you can only use selected primer combinations (see above).
  • As a package for 24, 48, 96 or 192 samples. This is the most cost-effective option and you can take advantage of our full range of primer pairs.

Sample requirements

Follow our Sample submission guidelines.

The samples must be delivered exactly in the concentration according to instructions! Too low a concentration could lead to a low PCR yield, a high concentration to different yields or even inhibition of the reaction (a high DNA concentration may be associated with a high concentration of inhibitors). When isolating DNA, keep in mind that more frequent washes and lower yields are certainly better than higher yields with inhibitors. Please provide samples for metagenomic analysis in strips or 96-well plates.

It is recommended that at least one of the samples you send is a negative control. For example, pure water can be used as a suitable control, from which you “isolate” DNA using the same procedure as from real samples (because not all isolation kits are DNA-free).

Please note that the success of the analysis depends very much on the integrity and purity of the DNA you provide! The use of degraded or contaminated DNA results in amplification artifacts. Contaminating substances that interfere with amplification are also to be avoided. We recommend removing RNA during DNA isolation.

 

 ORDER 

 

© SEQme s.r.o., 2012 - 2019. All rights reserved. Disclaimer.
webdesign Beneš & Michl