Metagenome / microbiome sequencing – from EUR 26 per sample!
If you want to analyze the presence of microorganisms in a particular environment - perform a so-called metagenome or microbiome analysis, Next-Generation sequencing is a very effective first choice tool, as it allows identification of all species in test samples. The most commonly used strategy is based on sequencing of amplicons obtained by amplifying hypervariable regions of the ribosomal subunit gene (such as 16S, 18S or ITS). These areas are traditionally used to identify organisms by comparing the sequences obtained with reference databases. (An alternative approach is shotgun sequencing of the whole sample, i.e. without amplification of 16S, 18S or ITS regions, or metatranscriptomic analysis. If you are interested in these services, please contact us.)
Our laboratory strategy is designed to be robust enough for different sample types. Your samples will be processed as follows:
Domain | Gene | Target region | Official primer name | Sequence | Product (bp) |
Bacteria | 16S rRNA | V4-V5 | V4-V5 515F | GTGYCAGCMGCCGCGGTAA | 420+ |
V4-V5 R926 | CCGYCAATTYMTTTRAGTTT | ||||
V3-V5 | V3-V5 F357 | CCTACGGGNGGCWGCAG | 694 | ||
V3-V5 R926 | CCGYCAATTYMTTTRAGTTT | ||||
V3-V4 | V3-V4 F357 | CCTACGGGNGGCWGCAG | 540 | ||
V3-V4 R805 | GACTACHVGGGTATCTAATCC | ||||
V4 | V4 515F | GTGYCAGCMGCCGCGGTAA | 252 | ||
V4 806R | GGACTACNVGGGTWTCTAAT | ||||
Archaea | 16S rRNA | 349-806 | Arch349F | GYGCASCAGKCGMGAAW | 528 |
Arch806R | GGACTACVSGGGTATCTAAT | ||||
Eukaryotes | 18S rRNA | ITS1+ITS2 | ITS1F | GGTCATTTAGAGGAAGTAA | 580+ |
ITS4R | TCCTCCGCTTATTGATATGC | ||||
ITS2 | ITS3F | GCATCGATGAAGAACGCAGC | 462 | ||
ITS4R | TCCTCCGCTTATTGATATGC | ||||
1391-3' end | Euk_1391F | GTACACACCGCCCGTC | 200-280 | ||
EukBr-7R | TGATCCTTCTGCAGGTTCACCTAC |
We guarantee that you get at least 20,000 reads for each sample that passes the initial quality control. Upon request, this output can be increased (charged).
The sequences obtained will be sorted according to the combination of indexes into files representing individual samples and analysis of sequencing quality indicators such as number and length of sequences, phred score, %GC, duplication level, etc. will be performed.
As output you will receive data in FASTQ format divided into files according to individual samples. Upon request, the outputs can be processed in another form. Please specify this when ordering.
Data analysisApart from laboratory processing of your samples it is also possible to order data analysis, which includes:
Results will be provided as tables/graphs and will demonstrate semi-quantified representation of microorganisms. If you already have raw data available, you can order their analysis separately. |
![]() |
Less than 4 weeks (data analysis not included)
Follow our Sample submission guidelines.
The samples must be delivered exactly in the concentration according to instructions! Too low a concentration could lead to a low PCR yield, a high concentration to different yields or even inhibition of the reaction (a high DNA concentration may be associated with a high concentration of inhibitors). When isolating DNA, keep in mind that more frequent washes and lower yields are certainly better than higher yields with inhibitors. Please provide samples for metagenomic analysis in strips or 96-well plates.
It is recommended that at least one of the samples you send is a negative control. For example, pure water can be used as a suitable control, from which you “isolate” DNA using the same procedure as from real samples (because not all isolation kits are DNA-free). We always include our own positive and negative control samples.
Please note that the success of the analysis depends very much on the integrity and purity of the DNA you provide! The use of degraded or contaminated DNA results in amplification artifacts. Contaminating substances that interfere with amplification are also to be avoided. We recommend removing RNA during DNA isolation.
The analysis can be ordered and commissioned on line as a package for 24, 48, 94 or 190 samples.