How tos and FAQs

What primers do you use for taxonomic analysis (based on 16S rDNA gene and other regions)?

Different hypervariable regions of genes can be used for taxonomic analysis. The table below lists primer sets we use to amplify these target regions and expected product sizes. Amplicons thus obtained are subjected to sequencing.

 

Domain Gene Target region Official Name Sequence Product (bp)
Bacteria 16S rRNA V4-V5 V4-V5 515F GTGYCAGCMGCCGCGGTAA 420+
V4-V5 R926 CCGYCAATTYMTTTRAGTTT
V3-V5 V3-V5 F357 CCTACGGGNGGCWGCAG 694
V3-V5 R926 CCGYCAATTYMTTTRAGTTT
V3-V4  V3-V4 F357 CCTACGGGNGGCWGCAG 540
V3-V4 R805 GACTACHVGGGTATCTAATCC
V4* V4 515F GTGYCAGCMGCCGCGGTAA 252
V4 806R GGACTACNVGGGTWTCTAAT
Archaea 16S rRNA 349-806* Arch349F GYGCASCAGKCGMGAAW 528
Arch806R GGACTACVSGGGTATCTAAT
Eukaryotes 18S rRNA ITS1+ITS2 ITS1F GGTCATTTAGAGGAAGTAA 580+
ITS4R TCCTCCGCTTATTGATATGC
ITS2* ITS3F GCATCGATGAAGAACGCAGC 462
ITS4R TCCTCCGCTTATTGATATGC
1391-3' end Euk_1391F GTACACACCGCCCGTC 200-280
EukBr-7R TGATCCTTCTGCAGGTTCACCTAC

*For these primer sets this service is available starting from a single sample

Please notice that the success of PCR amplification depends heavily on the integrity and purity of DNA you provide! Degraded or fragmented DNA produces weak amplicons with amplification artifacts. DNA with humic acids or other contaminants that interfere with amplification will also produce poor results. Removal of RNA during DNA purification is preferred. 

Back to the list
© SEQme s.r.o., 2012 - 2019. All rights reserved. Disclaimer.
webdesign Beneš & Michl