How tos and FAQs

Universal primers

The following universal primers are supplied by us free of charge: 

BGH-Reverse

TAGAAGGCACAGTCGAGG

BGH (bovine growth hormone) terminator, reverse primer

CMV-F

CGCAAATGGGCGGTAGGCGTG

CMV promoter, forward primer

EGFP-C

GATCACATGGTCCTGCTG

3’ end of EGFP, forward primer

EGFP-N

CCGTCCAGCTCGACCAG

5’ end of EGFP, reverse primer

M13F

TGTAAAACGACGGCCAGT

In lacZ gene

M13R

CAGGAAACAGCTATGACC

In lacZ gene

pGEX-3

GGAGCTGCATGTGTCAGAG

3’ end of MCS in pGEX vectors, reverse primer

pGEX-5

CTGGCAAGCCACGTTTGG

3’ end of glutathione-S-transferase, forward primer

pQE-F

CGGATAACAATTTCACACAG

pQE vectors, forward primer

pQE-R

GTTCTGAGGTCATTACTGG

pQE vectors, reverse primer

SP6

ATTTAGGTGACACTATAGAA

SP6 promoter, forward primer

T3

ATTAACCCTCACTAAAGGGA

T3 promoter, forward primer

T7 promoter

TAATACGACTCACTATAGGG

T7 promoter, forward primer

T7 terminator

GCTAGTTATTGCTCAGCGG

T7 terminator, reverse primer

 

If you wish to use one of the universal primers, your selection must always be specified when completing the order form. Select the appropriate universal primer from the drop-down menu, its sequence is filled in automatically.

 

Back to the list
© SEQme s.r.o., 2012 - 2019. All rights reserved. Disclaimer.
webdesign Beneš & Michl